string Functions (Strings)

Use functions from the string module or from base Python to print the following strings.

1. 'species' in all capital letters
2. 'gcagtctgaggattccaccttctacctgggagagaggacatactatatcgcagcagtggaggtggaatgg' with all of the occurrences of 'a' replaced with 'A'
3. ”    Thank goodness it’s Friday” without the leading white space (i.e., without the spaces before Thank)
4. The number of 'a's in 'gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg'.
5. Print the length of this dna sequence 'gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg'

Expected outputs for string Functions: 1