Python Assignment 2

Exercises

1. Print Strings

   Write a series of print statements that returns the following (include a blank line between each answer):

   1. Post hoc ergo propter hoc
   2. What’s up with scientists using all of this snooty latin?
   3. 'atgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgc'. Do this using the * operator to make 15 copies of 'atgc'.
   4. Darwin’s “On the origin of species” is a seminal work in biology.
   Expected outputs for Print Strings: 1

2. string Functions

   Use functions from the string module or from base Python to print the following strings.

   1. 'species' in all capital letters
   2. 'gcagtctgaggattccaccttctacctgggagagaggacatactatatcgcagcagtggaggtggaatgg' with all of the occurrences of 'a' replaced with 'A'
   3. ”    Thank goodness it’s Friday” without the leading white space (i.e., without the spaces before Thank)
   4. The number of 'a's in 'gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg'.
   5. Print the length of this dna sequence 'gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg'
   Expected outputs for string Functions: 1

3. string Methods

   Use string methods to print the following strings. Remember that methods work by adding the function to the end of the object name using a ., like

   mystring = 'Hello World'
   print mystring.lower()
   

   1. 'species' in all capital letters
   2. 'gcagtctgaggattccaccttctacctgggagagaggacatactatatcgcagcagtggaggtggaatgg' with all of the occurences of 'a' replaced with 'A'
   3. "    Thank goodness it's Friday" without the leading white space (i.e., without the spaces before "Thank")
   4. The number of 'a's in 'gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg'.
   Expected outputs for string Methods: 1

4. Long Strings

   For the DNA sequence below determine the following properties and print them to the screen (you can cut and paste the following into your code, it’s a lot longer than you can see on the screen, but just select the whole thing and when you paste it into Python you’ll see what it looks like):

   dna='ttcacctatgaatggactgtccccaaagaagtaggacccactaatgcagatcctgtgtgtctagctaagatgtattattctgctgtggatcccactaaagatatattcactgggcttattgggccaatgaaaatatgcaagaaaggaagtttacatgcaaatgggagacagaaagatgtagacaaggaattctatttgtttcctacagtatttgatgagaatgagagtttactcctggaagataatattagaatgtttacaactgcacctgatcaggtggataaggaagatgaagactttcaggaatctaataaaatgcactccatgaatggattcatgtatgggaatcagccgggtctcactatgtgcaaaggagattcggtcgtgtggtacttattcagcgccggaaatgaggccgatgtacatggaatatacttttcaggaaacacatatctgtggagaggagaacggagagacacagcaaacctcttccctcaaacaagtcttacgctccacatgtggcctgacacagaggggacttttaatgttgaatgccttacaactgatcattacacaggcggcatgaagcaaaaatatactgtgaaccaatgcaggcggcagtctgaggattccaccttctacctgggagagaggacatactatatcgcagcagtggaggtggaatgggattattccccacaaagggagtgggattaggagctgcatcatttacaagagcagaatgtttcaaatgcatttttagataagggagagttttacataggctcaaagtacaagaaagttgtgtatcggcagtatactgatagcacattccgtgttccagtggagagaaaagctgaagaagaacatctgggaattctaggtccacaacttcatgcagatgttggagacaaagtcaaaattatctttaaaaacatggccacaaggccctactcaatacatgcccatggggtacaaacagagagttctacagttactccaacattaccaggtaaactctcacttacgtatggaaaatcccagaaagatctggagctggaacagaggattctgcttgtattccatgggcttattattcaactgtggatcaagttaaggacctctacagtggattaattggccccctgattgtttgtcgaagaccttacttgaaagtattcaatcccagaaggaagctggaatttgcccttctgtttctagtttttgatgagaatgaatcttggtacttagatgacaacatcaaaacatactctgatcaccccgagaaagtaaacaaagatgatgaggaattcatagaaagcaataaaatgcatgctattaatggaagaatgtttggaaacct'

   1. How many occurrences of 'gagg' occur in the sequence?
   2. What is the starting position of the first occurrence of 'atta'? Report the actual base pair position as a human would understand it.
   3. How long is the sequence?
   4. What is the GC content of the sequence? The GC content is the percentage of bases that are either G or C (as a percentage of total base pairs) Print the result as “The GC content of this sequence is XX.XX%” where XX.XX is the actual GC content. Do this using a formatted string.
   Expected outputs for Long Strings: 1

5. GC Content 1

   A colleague has produced a file with one DNA sequence on each line. Download the file and load it into Python using numpy.loadtxt(). You will need to use the optional argument dtype = str to tell loadtxt() that the data is composed of strings.

   Calculate the GC content of each sequence. The GC content is the percentage of bases that are either G or C (as a percentage of total base pairs). Print the result for each sequence as “The GC content of the sequence is XX.XX%” where XX.XX is the actual GC content.

   Expected outputs for GC Content 1: 1

6. Split Strings

   You have a data file with a single taxonomy column in it. This column contains the family, genus, and species for a single taxonomic group. You need to figure out how to split that information into separate values for family, genus, and species. To solve the basic problem take a single example string, 'Ornithorhynchidae Ornithorhynchus anatinus', split it into three separate strings using a Python command, and then print the family, genus, and species, each on a separate line.

   Expected outputs for Split Strings: 1

Assignment submission & checklist